pTMB304_ZFcharm_Kv1_Prnp_SCR
(Plasmid
#220842)
-
PurposeAAV genome expressing ZFcharm Kv1 targeting Prnp; scrambled self-silencing binding site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV expression plasmid
- Backbone size w/o insert (bp) 4568
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZFcharm Kv1
-
SpeciesH. sapiens (human); Apodemus sylvaticus
-
Insert Size (bp)2070
-
MutationN/A
- Promoter EFS
-
Tag
/ Fusion Protein
- HAtag (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgggaaagtgatgtcgtgtac
- 3′ sequencing primer ggatacgctgctttaatgcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTMB304_ZFcharm_Kv1_Prnp_SCR was a gift from Jonathan Weissman (Addgene plasmid # 220842 ; http://n2t.net/addgene:220842 ; RRID:Addgene_220842) -
For your References section:
Brainwide silencing of prion protein by AAV-mediated delivery of an engineered compact epigenetic editor. Neumann EN, Bertozzi TM, Wu E, Serack F, Harvey JW, Brauer PP, Pirtle CP, Coffey A, Howard M, Kamath N, Lenz K, Guzman K, Raymond MH, Khalil AS, Deverman BE, Minikel EV, Vallabh SM, Weissman JS. Science. 2024 Jun 28;384(6703):ado7082. doi: 10.1126/science.ado7082. Epub 2024 Jun 28. 10.1126/science.ado7082 PubMed 38935715