EF1a-L274GMmMetRS-T2A-mCherry
(Plasmid #220800)

• Purpose: Lentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistance
• Depositing Lab: Elizabeth Kirby
• Publication: Sridharan et al Stem Cell Res Ther. 2024 Jun 26;15(1):186. doi: 10.1186/s13287-024-03792-3.

Backbone

• Vector backbone: pLJM1-EGFP
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 5600
• Total vector size (bp): 9651
• Modifications to backbone: Inserted EF1a-L274GMmMetRS-mCherry plus hPGK-PuroR, removed GFP
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Mars1
• Species: M. musculus (mouse)
• Insert Size (bp): 3493
• Mutation: mutation in MetRS to change aa 274 from L to G
• GenBank ID: NM_001003913
• Entrez Gene: Mars1 (a.k.a. Mars, Metrs, Mtrns)
• Promoter: EF1a
• Tags / Fusion Proteins:
  • T2A-mCherry (C terminal on insert)
  • 2xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• Supplemental Documents:
  • Kirby_Y7N_1_P034_peak_2_pLann.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry