pRD551
(Plasmid
#220789)
-
PurposeOverexpresses HMfC in E. coli cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET30b
- Backbone size w/o insert (bp) 5204
- Total vector size (bp) 5537
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHMfC
-
Alt nameMfer_0945
-
Alt nameE3GZL0
-
SpeciesMethanothermus fervidus
-
Insert Size (bp)333
-
GenBank IDMFER_RS04800
- Promoter T7 promotor
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.01.543357 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRD551 was a gift from Remus Dame (Addgene plasmid # 220789 ; http://n2t.net/addgene:220789 ; RRID:Addgene_220789) -
For your References section:
Novel histones and histone variant families in prokaryotes. Schwab S, Boyle AL, Dame RT. bioRxiv 2023.06.01.543357 10.1101/2023.06.01.543357