pEB355
(Plasmid
#22070)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 22070 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUT18C
- Backbone size (bp) 3033
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- T18 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AGTTCTCGCCGGATGTACTGGAAACGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEB355 was a gift from Emmanuelle Bouveret (Addgene plasmid # 22070 ; http://n2t.net/addgene:22070 ; RRID:Addgene_22070) -
For your References section:
A protein network for phospholipid synthesis uncovered by a variant of the tandem affinity purification method in Escherichia coli. Gully D, Bouveret E. Proteomics. 2006 Jan . 6(1):282-93. 10.1002/pmic.200500115 PubMed 16294310
