LMPd Ametrine Got2 shRNA#3
(Plasmid
#220593)
-
PurposeRetroviral vector with Ametrine marker for expression shRNA with an "UltramiR" microRNA scaffold
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220593 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneLMPd Amt
-
Backbone manufacturerChen et al. 2014
-
Vector typeRetroviral
-
Selectable markersAmetrine
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGot2 shRNA
-
gRNA/shRNA sequenceCGCAGACCACATTACAGAAATT
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)97
-
Entrez GeneGot2 (a.k.a. Got-2, mAspAT, FABP-pm, AL022787, MGC102129, MGC115763)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer cgatcctccctttatccagcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://pubmed.ncbi.nlm.nih.gov/37333111/ for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LMPd Ametrine Got2 shRNA#3 was a gift from Russell Jones (Addgene plasmid # 220593 ; http://n2t.net/addgene:220593 ; RRID:Addgene_220593) -
For your References section:
(13)C metabolite tracing reveals glutamine and acetate as critical in vivo fuels for CD8(+) T cells. Ma EH, Dahabieh MS, DeCamp LM, Kaymak I, Kitchen-Goosen SM, Roy DG, Verway MJ, Johnson RM, Samborska B, Scullion CA, Steadman M, Vos M, Roddy TP, Krawczyk CM, Williams KS, Sheldon RD, Jones RG. bioRxiv [Preprint]. 2023 Jun 11:2023.06.09.544407. doi: 10.1101/2023.06.09.544407. 10.1101/2023.06.09.544407 PubMed 37333111
