LT3GEPIR-CCND1shRNA3
(Plasmid
#220579)
-
PurposeTo inducibly knockdown CCND1 expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220579 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLT3GEPIR
-
Backbone manufacturerDr. Johannes Zuber
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCCND1 shRNA3
-
gRNA/shRNA sequenceATTGGAATAGCTTCTGGAAT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)125
-
Entrez GeneCCND1 (a.k.a. BCL1, D11S287E, PRAD1, U21B31)
- Promoter TRE3G (TetOP) promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGTTTGAATGAGGCTTCAGTAC
- 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LT3GEPIR-CCND1shRNA3 was a gift from Sean Lee (Addgene plasmid # 220579 ; http://n2t.net/addgene:220579 ; RRID:Addgene_220579)