pMSCV-BLU-VIPR
(Plasmid
#220497)
-
Purpose(Empty Backbone) Retroviral plasmid allowing for potent induction of gRNA using blue light. The plasmid contains VPR-EL222-2A-Thy1.1 and the C120 element followed by cloning sites for ribozyme flanked gRNA (RGR).
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220497 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneGFP-RV
-
Vector typeMammalian Expression, Retroviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CGCTTGGGCGGTACAACTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://pubmed.ncbi.nlm.nih.gov/37986968/ for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-BLU-VIPR was a gift from Alexander Espinosa (Addgene plasmid # 220497 ; http://n2t.net/addgene:220497 ; RRID:Addgene_220497) -
For your References section:
Light induced expression of gRNA allows for optogenetic gene editing of T lymphocytes in vivo. Pulgarin DV, Pelo N, Ferrandiz L, Trselic T, Nyberg WA, Bowlin G, Espinosa A. bioRxiv [Preprint]. 2023 Nov 10:2023.11.09.566272. doi: 10.1101/2023.11.09.566272. 10.1101/2023.11.09.566272 PubMed 37986968
Map uploaded by the depositor.
