Skip to main content
Addgene

pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
(Plasmid #220493)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220493 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCAG-eSpCas9-2A-GFP
  • Backbone manufacturer
    Addgene #79145
  • Backbone size w/o insert (bp) 10225
  • Total vector size (bp) 10245
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting DNA-PKcs (PRKDC) exon 1
  • Species
    H. sapiens (human)
  • Entrez Gene
    PRKDC (a.k.a. DNA-PKC, DNA-PKcs, DNAPK, DNAPKc, DNPK1, HYRC, HYRC1, IMD26, XRCC7, p350)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer SEQ-U6-F (ATGGACTATCATATGCTTACCG)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs was a gift from Sébastien Britton (Addgene plasmid # 220493 ; http://n2t.net/addgene:220493 ; RRID:Addgene_220493)

  • For your References section:

    Identification of the main barriers to Ku accumulation in chromatin. Bossaert M, Moreno A, Peixoto A, Pillaire MJ, Chanut P, Frit P, Calsou P, Loparo JJ, Britton S. bioRxiv [Preprint]. 2024 Jan 4:2024.01.03.574002. doi: 10.1101/2024.01.03.574002. 10.1101/2024.01.03.574002 PubMed 38260538
Related items: