pcDNA3.3−3xFLAG−AGO2(S387A)
(Plasmid #220462)

• Purpose: Express S387 phospho-null mutant human AGO2 with N-terminal 3xFLAG tag in mammalian cells
• Depositing Lab: David Bartel
• Publication: Wang et al Mol Cell. 2024 Jul 10:S1097-2765(24)00533-1. doi: 10.1016/j.molcel.2024.06.026.

Backbone

• Vector backbone: pcDNA3.3
• Total vector size (bp): 8071
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human AGO2
• Alt name: Argonaute2
• Species: H. sapiens (human)
• Insert Size (bp): 2658
• Mutation: Serine 387 to alanine
• Entrez Gene: AGO2 (a.k.a. CASC7, EIF2C2, LESKRES, LINC00980, PPD, Q10)
• Promoter: CMV
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACTCTAGAGGATCGAACCCTTG

Resource Information

• Supplemental Documents:
  • pcDNA3.3-3xFLAG-hAGO2_S387A.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.10.15.562437 for bioRxiv preprint.