pRRL_H1shLacZ_PGK_eGFP_Teto
(Plasmid
#22038)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22038 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRL.SIN.cPPT.PGK.GFP
- Backbone size w/o insert (bp) 7700
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsHB101
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshlacZ
-
Insert Size (bp)59
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shLacZ oligo sequence is: 5'-aaaaacgactacacaaatcagcgatttctcttgaaaatcgctgatttgtgtgtcg
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL_H1shLacZ_PGK_eGFP_Teto was a gift from Didier Trono (Addgene plasmid # 22038 ; http://n2t.net/addgene:22038 ; RRID:Addgene_22038)