pCAG-2dV-Camui (T305D/T306D)
(Plasmid
#220368)
-
PurposeT305D/T306D phosphomimetic mutant of pCAG-2dV-Camui
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220368 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4758
- Total vector size (bp) 8415
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemVenus(Y145W)-mVenus(Y145W)-rat CaMK2 alpha(T305D/T306D)-mEGFP(A206K)
-
Alt name2dV-Camui(T305D/T306D)
-
Alt nameFRET-based conformation sensor for calcium/calmodulin-dependent protein kinase type II subunit alpha mutant (T305D/T306D)
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)3657
-
Mutationchanged both Threonine 305 and 306 to aspartic acid
-
GenBank IDNM_012920.1, NP_037052.1
-
Entrez GeneCamk2a (a.k.a. PK2CDD, PKCCD)
- Promoter CAG
-
Tags
/ Fusion Proteins
- mVenus(Y145W)-mVenus(Y145W) (N terminal on insert)
- mEGFP(A206K) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.08.01.549180v1.full.pdf for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-2dV-Camui (T305D/T306D) was a gift from Ryohei Yasuda (Addgene plasmid # 220368 ; http://n2t.net/addgene:220368 ; RRID:Addgene_220368) -
For your References section:
Dendritic, delayed, stochastic CaMKII activation in behavioural time scale plasticity. Jain A, Nakahata Y, Pancani T, Watabe T, Rusina P, South K, Adachi K, Yan L, Simorowski N, Furukawa H, Yasuda R. Nature. 2024 Oct 9. doi: 10.1038/s41586-024-08021-8. 10.1038/s41586-024-08021-8 PubMed 39385027