Skip to main content
Addgene

pCAG-2dV-Camui (T286A)
(Plasmid #220367)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220367 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4758
  • Total vector size (bp) 8415
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mVenus(Y145W)-mVenus(Y145W)-rat CaMK2 alpha(T286A)-mEGFP(A206K)
  • Alt name
    2dV-Camui(T286A)
  • Alt name
    FRET-based conformation sensor for calcium/calmodulin-dependent protein kinase type II subunit alpha mutant (T286A)
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    3657
  • Mutation
    changed Threonine 286 to Alanine
  • GenBank ID
    NM_012920.1, NP_037052.1
  • Entrez Gene
    Camk2a (a.k.a. PK2CDD, PKCCD)
  • Promoter CAG
  • Tags / Fusion Proteins
    • mVenus(Y145W)-mVenus(Y145W) (N terminal on insert)
    • mEGFP(A206K) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-2dV-Camui (T286A) was a gift from Ryohei Yasuda (Addgene plasmid # 220367 ; http://n2t.net/addgene:220367 ; RRID:Addgene_220367)

  • For your References section:

    Dendritic, delayed, stochastic CaMKII activation in behavioural time scale plasticity. Jain A, Nakahata Y, Pancani T, Watabe T, Rusina P, South K, Adachi K, Yan L, Simorowski N, Furukawa H, Yasuda R. Nature. 2024 Oct 9. doi: 10.1038/s41586-024-08021-8. 10.1038/s41586-024-08021-8 PubMed 39385027
Related items: