pSuperior.retro.neo GFP shScramble
(Plasmid
#220357)
-
PurposeRetroviral expression vector for an shScramble
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220357 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSUPERIOR.retro.neo+gfp
-
Backbone manufacturerOligoengine
- Backbone size w/o insert (bp) 7385
-
Vector typeRetroviral, RNAi
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshScramble
-
gRNA/shRNA sequenceGAACCGGATTATACTACAGGT
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGAAGCCTTGGCTTTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also see the second reference: https://doi.org/10.1016/j.celrep.2019.07.031.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSuperior.retro.neo GFP shScramble was a gift from David Kashatus (Addgene plasmid # 220357 ; http://n2t.net/addgene:220357 ; RRID:Addgene_220357) -
For your References section:
Proteome-wide copy-number estimation from transcriptomics. Sweatt AJ, Griffiths CD, Groves SM, Paudel BB, Wang L, Kashatus DF, Janes KA. Mol Syst Biol. 2024 Sep 27. doi: 10.1038/s44320-024-00064-3. 10.1038/s44320-024-00064-3 PubMed 39333715