V5-BS2-NLS (Nucleoplasmin)
(Plasmid
#220342)
-
PurposeMammalian expression vector BS2 in nucleus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backboned0
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBS2
-
SpeciesBacillus subtilis
-
Insert Size (bp)1563
- Promoter CMV
-
Tags
/ Fusion Proteins
- V5 tag (N terminal on insert)
- NLS (Nucleus localization sequence) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V5-BS2-NLS (Nucleoplasmin) was a gift from Bryan Dickinson (Addgene plasmid # 220342 ; http://n2t.net/addgene:220342 ; RRID:Addgene_220342) -
For your References section:
Bioorthogonal masked acylating agents for proximity-dependent RNA labelling. Pani S, Qiu T, Kentala K, Azizi SA, Dickinson BC. Nat Chem. 2024 Apr 9. doi: 10.1038/s41557-024-01493-1. 10.1038/s41557-024-01493-1 PubMed 38594368