pXPR_003.gEZH2
(Plasmid
#220318)
-
PurposeExpresses guide RNA for CRISPR/Cas9 knockout of EZH2 for knockout/rescue experiments in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXPR_003
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 8303
- Total vector size (bp) 8323
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEZH2 gRNA
-
Alt nameCRISPR/Cas9 gRNA targeting Enhancer Of Zeste 2 Polycomb Repressive Complex 2 Subunit
-
gRNA/shRNA sequenceAATAATCAGGCATACCATCT
-
SpeciesH. sapiens (human)
-
GenBank IDQ15910
-
Entrez GeneEZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_003.gEZH2 was a gift from Chen Davidovich (Addgene plasmid # 220318 ; http://n2t.net/addgene:220318 ; RRID:Addgene_220318) -
For your References section:
Inseparable RNA binding and chromatin modification activities of a nucleosome-interacting surface in EZH2. Gail EH, Healy E, Flanigan SF, Jones N, Ng XH, Uckelmann M, Levina V, Zhang Q, Davidovich C. Nat Genet. 2024 May 14. doi: 10.1038/s41588-024-01740-8. 10.1038/s41588-024-01740-8 PubMed 38744974