Skip to main content
Addgene

pXPR_003.gEZH2
(Plasmid #220318)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220318 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pXPR_003
  • Backbone manufacturer
    Broad Institute
  • Backbone size w/o insert (bp) 8303
  • Total vector size (bp) 8323
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EZH2 gRNA
  • Alt name
    CRISPR/Cas9 gRNA targeting Enhancer Of Zeste 2 Polycomb Repressive Complex 2 Subunit
  • gRNA/shRNA sequence
    AATAATCAGGCATACCATCT
  • Species
    H. sapiens (human)
  • GenBank ID
    Q15910
  • Entrez Gene
    EZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_003.gEZH2 was a gift from Chen Davidovich (Addgene plasmid # 220318 ; http://n2t.net/addgene:220318 ; RRID:Addgene_220318)
  • For your References section:

    Inseparable RNA binding and chromatin modification activities of a nucleosome-interacting surface in EZH2. Gail EH, Healy E, Flanigan SF, Jones N, Ng XH, Uckelmann M, Levina V, Zhang Q, Davidovich C. Nat Genet. 2024 May 14. doi: 10.1038/s41588-024-01740-8. 10.1038/s41588-024-01740-8 PubMed 38744974