pcDNA3.1-TRPV1exCellHalo
(Plasmid #220307)

• Purpose: Mammalian expression vector for a subunit of rat TRPV1 with circularly permutated HaloTag inserted between the S5 and S6 transmembrane helices
• Depositing Lab: Eric Senning
• Publication: Mott et al J Gen Physiol. 2024 (in press)

Backbone

• Vector backbone: pcDNA3.1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rTRPV1exCellHalo
• Alt name: TRPV1cpHaloTag
• Species: R. norvegicus (rat)
• Insert Size (bp): 3477
• Mutation: linker included to insert cpHaloTag (
• Entrez Gene: Trpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
• Promoter: CMV promoter
• Tag / Fusion Protein:
  • circularly permutated Halotag (Deo et al., Nat Chem Biol., 2021)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • TRPV1cpHalotag_forAddgeneExport20240423.pcDNA3.gb
• A portion of this plasmid was derived from a plasmid made by: The rat TRPV1 was acquired from Sharona Gordon at University of Washington.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Industry MTA
  • HaloTag Vector Limited Use Label License for Distribution to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2024.05.09.593209 for bioRxiv preprint.