Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-TRPV1exCellHalo
(Plasmid #220307)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 220307 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rTRPV1exCellHalo
  • Alt name
    TRPV1cpHaloTag
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3477
  • Mutation
    linker included to insert cpHaloTag (
  • Entrez Gene
    Trpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • circularly permutated Halotag (Deo et al., Nat Chem Biol., 2021)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.05.09.593209 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-TRPV1exCellHalo was a gift from Eric Senning (Addgene plasmid # 220307 ; http://n2t.net/addgene:220307 ; RRID:Addgene_220307)
  • For your References section:

    Fluorescence labeling strategies for cell surface expression of TRPV1. Mott T, Wulffraat G, Eddins A, Mehl R, Senning E. J Gen Physiol. 2024 (in press) 10.1085/jgp.202313523