pFB1.HMBP.PrS.EZH2-mt2
(Plasmid
#220240)
-
PurposeExpression of an EZH2 mutant in insect cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220240 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFast.Bac1 (pFB1.HMBP.A3.PrS.ybbR)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5986
- Total vector size (bp) 8174
-
Modifications to backboneN-terminal His-MBP PreScission cleavage site
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEZH2 mt 2
-
Alt nameEnhancer Of Zeste 2 Polycomb Repressive Complex 2 Subunit mutant 2
-
Alt nameHistone-lysine N-methyltransferase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2934
-
MutationF32A, R34A, D36A, K39A, PRKKKR494-499NAAIRS
-
GenBank IDQ15910
-
Entrez GeneEZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- 6x His, MBP (N terminal on backbone)
Cloning Information
- Cloning method Other
- 5′ sequencing primer GGATTATTCATACCGTCCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB1.HMBP.PrS.EZH2-mt2 was a gift from Chen Davidovich (Addgene plasmid # 220240 ; http://n2t.net/addgene:220240 ; RRID:Addgene_220240) -
For your References section:
Inseparable RNA binding and chromatin modification activities of a nucleosome-interacting surface in EZH2. Gail EH, Healy E, Flanigan SF, Jones N, Ng XH, Uckelmann M, Levina V, Zhang Q, Davidovich C. Nat Genet. 2024 May 14. doi: 10.1038/s41588-024-01740-8. 10.1038/s41588-024-01740-8 PubMed 38744974