pFB1.HMBP.PrS.EZH2-mt2
(Plasmid #220240)

• Purpose: Expression of an EZH2 mutant in insect cells.
• Depositing Lab: Chen Davidovich
• Publication: Gail et al Nat Genet. 2024 May 14. doi: 10.1038/s41588-024-01740-8.

Backbone

• Vector backbone: pFast.Bac1 (pFB1.HMBP.A3.PrS.ybbR)
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5986
• Total vector size (bp): 8174
• Modifications to backbone: N-terminal His-MBP PreScission cleavage site
• Vector type: Insect Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: EZH2 mt 2
• Alt name: Enhancer Of Zeste 2 Polycomb Repressive Complex 2 Subunit mutant 2
• Alt name: Histone-lysine N-methyltransferase
• Species: H. sapiens (human)
• Insert Size (bp): 2934
• Mutation: F32A, R34A, D36A, K39A, PRKKKR494-499NAAIRS
• GenBank ID: Q15910
• Entrez Gene: EZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
• Promoter: Polyhedrin
• Tag / Fusion Protein:
  • 6x His, MBP (N terminal on backbone)

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: GGATTATTCATACCGTCCCA

Resource Information

• Supplemental Documents:
  • pFB1_EZH2mt2_02.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry