pCDF-rM1PYK
(Plasmid
#220232)
-
PurposeInducible expression of rabbit muscle pyruvate kinase isoform 1
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDFDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 7000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRabbit muscle pyruvate kinase
-
Alt namerM1PYK
-
Entrez GenePKM (a.k.a. PKM2)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-MBP-SUMO (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGATCTCGACGCTCTCCCT
- 3′ sequencing primer GATTATGCGGCCGTGTACAA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expression and purification of an exogenous PYK requires the E. coli strain QTF60, a BL21-derivative lacking both endogenous PYK genes (pykF and pykA).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDF-rM1PYK was a gift from Aron Fenton & Liskin Swint-Kruse (Addgene plasmid # 220232 ; http://n2t.net/addgene:220232 ; RRID:Addgene_220232) -
For your References section:
PYK-SubstitutionOME: an integrated database containing allosteric coupling, ligand affinity and mutational, structural, pathological, bioinformatic and computational information about pyruvate kinase isozymes. Swint-Kruse L, Dougherty LL, Page B, Wu T, O'Neil PT, Prasannan CB, Timmons C, Tang Q, Parente DJ, Sreenivasan S, Holyoak T, Fenton AW. Database (Oxford). 2023 May 3;2023:baad030. doi: 10.1093/database/baad030. 10.1093/database/baad030 PubMed 37171062