Skip to main content
Addgene

pCDF-rM1PYK
(Plasmid #220232)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220232 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCDFDuet-1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 7000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rabbit muscle pyruvate kinase
  • Alt name
    rM1PYK
  • Entrez Gene
    PKM (a.k.a. PKM2)
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-MBP-SUMO (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGATCTCGACGCTCTCCCT
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expression and purification of an exogenous PYK requires the E. coli strain QTF60, a BL21-derivative lacking both endogenous PYK genes (pykF and pykA).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDF-rM1PYK was a gift from Aron Fenton & Liskin Swint-Kruse (Addgene plasmid # 220232 ; http://n2t.net/addgene:220232 ; RRID:Addgene_220232)

  • For your References section:

    PYK-SubstitutionOME: an integrated database containing allosteric coupling, ligand affinity and mutational, structural, pathological, bioinformatic and computational information about pyruvate kinase isozymes. Swint-Kruse L, Dougherty LL, Page B, Wu T, O'Neil PT, Prasannan CB, Timmons C, Tang Q, Parente DJ, Sreenivasan S, Holyoak T, Fenton AW. Database (Oxford). 2023 May 3;2023:baad030. doi: 10.1093/database/baad030. 10.1093/database/baad030 PubMed 37171062
Related items: