Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGM84
(Plasmid #220172)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220172 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCRISPRia-V2
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BTF3 (sgRNA)
  • gRNA/shRNA sequence
    GCGGACAGGCGCACCCGCTC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    BTF3 (a.k.a. BETA-NAC, BTF3a, BTF3b, NACB)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGM84 was a gift from Jonathan Weissman (Addgene plasmid # 220172 ; http://n2t.net/addgene:220172 ; RRID:Addgene_220172)
  • For your References section:

    Triaging of alpha-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology. Muthukumar G, Stevens TA, Inglis AJ, Esantsi TK, Saunders RA, Schulte F, Voorhees RM, Guna A, Weissman JS. Mol Cell. 2024 Mar 21;84(6):1101-1119.e9. doi: 10.1016/j.molcel.2024.01.028. Epub 2024 Feb 29. 10.1016/j.molcel.2024.01.028 PubMed 38428433