pGM79
(Plasmid
#220171)
-
PurposeCRISRPi guide RNA against MARCHF5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCRISPRia-V2
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMARCHF5 (sgRNA)
-
gRNA/shRNA sequenceGGGAGTAGGCCGCAGTCCGG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneMARCHF5 (a.k.a. MARCH-V, MARCH5, MITOL, RNF153)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGM79 was a gift from Jonathan Weissman (Addgene plasmid # 220171 ; http://n2t.net/addgene:220171 ; RRID:Addgene_220171) -
For your References section:
Triaging of alpha-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology. Muthukumar G, Stevens TA, Inglis AJ, Esantsi TK, Saunders RA, Schulte F, Voorhees RM, Guna A, Weissman JS. Mol Cell. 2024 Mar 21;84(6):1101-1119.e9. doi: 10.1016/j.molcel.2024.01.028. Epub 2024 Feb 29. 10.1016/j.molcel.2024.01.028 PubMed 38428433