MSCV-IRES-tagBFP
(Plasmid
#219965)
-
Purposeexpress TagBFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagBFP
-
SpeciesEntacmaea quadricolor
-
Insert Size (bp)702
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGGCTCTCCTCAAGCGTATT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIlia Voskoboinik's Lab Sir Peter MacCallum Department of Oncology, The University of Melbourne, Parkville, 3052, Australia
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-IRES-tagBFP was a gift from Mohamed Fareh (Addgene plasmid # 219965 ; http://n2t.net/addgene:219965 ; RRID:Addgene_219965)