MSCV-BCR-ABL1-p190-IRES-EGFP
(Plasmid
#219964)
-
PurposeExpress human BCR-ABL1-P190 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219964 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV-IRES-EGFP
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBCR-ABL1-P190
-
SpeciesH. sapiens (human)
-
Entrez GeneABL1 (a.k.a. ABL, BCR-ABL, CHDSKM, JTK7, bcr/abl, c-ABL, c-ABL1, p150, v-abl)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer cacctgacccctgactgc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPaul Ekert's Lab Murdoch Children’s Research Institute, Royal Children's Hospital, 50 Flemington Rd, Parkville, Melbourne, 3052, Australia
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-BCR-ABL1-p190-IRES-EGFP was a gift from Mohamed Fareh (Addgene plasmid # 219964 ; http://n2t.net/addgene:219964 ; RRID:Addgene_219964)