Skip to main content
Addgene

MSCV-BCR-ABL1-p190-IRES-EGFP
(Plasmid #219964)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219964 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MSCV-IRES-EGFP
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BCR-ABL1-P190
  • Species
    H. sapiens (human)
  • Entrez Gene
    ABL1 (a.k.a. ABL, BCR-ABL, CHDSKM, JTK7, bcr/abl, c-ABL, c-ABL1, p150, v-abl)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer cacctgacccctgactgc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Paul Ekert's Lab Murdoch Children’s Research Institute, Royal Children's Hospital, 50 Flemington Rd, Parkville, Melbourne, 3052, Australia

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-BCR-ABL1-p190-IRES-EGFP was a gift from Mohamed Fareh (Addgene plasmid # 219964 ; http://n2t.net/addgene:219964 ; RRID:Addgene_219964)