pSN668
(Plasmid
#219962)
-
PurposeExpressed sfGFP fused human KIF1Bß (1770 a.a. isoform) in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAcebac1
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecodon optimized human KIF1Bß (1770a.a. isoform)
-
SpeciesH. sapiens (human)
-
Entrez GeneKIF1B (a.k.a. CMT2, CMT2A, CMT2A1, HMSNII, KLP, NBLST1)
- Promoter polyhedrin
-
Tag
/ Fusion Protein
- sfGFP::2xStrepII tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttttactgttttcgtaacag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSN668 was a gift from Shinsuke Niwa (Addgene plasmid # 219962 ; http://n2t.net/addgene:219962 ; RRID:Addgene_219962)