Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CMV-CD4-sTb(C)-M13-GFP
(Plasmid #219780)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219780 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CD4-sTb(C)-M13-GFP
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • HA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acgactcactatagggagaccc
  • 3′ sequencing primer GATCAGCGAGCTCTAGctcgag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-CD4-sTb(C)-M13-GFP was a gift from Christina Kim (Addgene plasmid # 219780 ; http://n2t.net/addgene:219780 ; RRID:Addgene_219780)
  • For your References section:

    Rapid, biochemical tagging of cellular activity history in vivo. Zhang R, Anguiano M, Aarrestad IK, Lin S, Chandra J, Vadde SS, Olson DE, Kim CK. bioRxiv [Preprint]. 2024 May 14:2023.09.06.556431. doi: 10.1101/2023.09.06.556431. 10.1101/2023.09.06.556431 PubMed 38798353