Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

U6+27-16pf
(Plasmid #21976)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21976 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    U6+27
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U6 miR-16 perfect
  • Insert Size (bp)
    50

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

miR-16 perfect CMV sponge and U6 sponge:

CGCCAUAUUUACGUGCUGCUA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6+27-16pf was a gift from Phil Sharp (Addgene plasmid # 21976 ; http://n2t.net/addgene:21976 ; RRID:Addgene_21976)
  • For your References section:

    MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert MS, Neilson JR, Sharp PA. Nat Methods. 2007 Sep . 4(9):721-6. 10.1038/nmeth1079 PubMed 17694064