Skip to main content
Addgene

pNK3071
(Plasmid #219755)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219755 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Level P-like
  • Backbone size w/o insert (bp) 4919
  • Vector type
    Plant Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mcitHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH
  • Alt name
    FBP3
  • Species
    Escherichia coli, Neonothopanus nambi, Aspergillus nidulans, Mycena citricolor
  • Insert Size (bp)
    17306

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer ggcaggatatattgtggtgta
  • 3′ sequencing primer ggataaaccttttcacgccct
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Synthetic

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pNOS - KanR - tOCS | p35s_0.4kb - 5'UTR_TMV - mcitHispS - tOCS | pCmYLCV - NpgA - tATP | p35s_1.3kb - 5'UTR_TMV - nnLuz_v4 - tAct2 | p35s_0.4kb - 5'UTR_TMV - nnCPH - tOCS | pFMV - nnH3H_v2 - tNOS

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNK3071 was a gift from Alexander Mishin (Addgene plasmid # 219755 ; http://n2t.net/addgene:219755 ; RRID:Addgene_219755)

  • For your References section:

    An improved pathway for autonomous bioluminescence imaging in eukaryotes. Shakhova ES, Karataeva TA, Markina NM, Mitiouchkina T, Palkina KA, Perfilov MM, Wood MG, Hoang TT, Hall MP, Fakhranurova LI, Alekberova AE, Malyshevskaia AK, Gorbachev DA, Bugaeva EN, Pletneva LK, Babenko VV, Boldyreva DI, Gorokhovatsky AY, Balakireva AV, Gao F, Choob VV, Encell LP, Wood KV, Yampolsky IV, Sarkisyan KS, Mishin AS. Nat Methods. 2024 Mar;21(3):406-410. doi: 10.1038/s41592-023-02152-y. Epub 2024 Jan 22. 10.1038/s41592-023-02152-y PubMed 38253843
Related items: