Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNK5664
(Plasmid #219747)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219747 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Level 1-like
  • Backbone size w/o insert (bp) 2231
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pCMV - nnLuz_v4 - tSV40
  • Species
    Neonothopanus nambi
  • Insert Size (bp)
    1732

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer cctataaaaataggcgtatcacgaggcag
  • 3′ sequencing primer agtcagtgagcgaggaagcctg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Synthetic

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNK5664 was a gift from Alexander Mishin (Addgene plasmid # 219747 ; http://n2t.net/addgene:219747 ; RRID:Addgene_219747)
  • For your References section:

    An improved pathway for autonomous bioluminescence imaging in eukaryotes. Shakhova ES, Karataeva TA, Markina NM, Mitiouchkina T, Palkina KA, Perfilov MM, Wood MG, Hoang TT, Hall MP, Fakhranurova LI, Alekberova AE, Malyshevskaia AK, Gorbachev DA, Bugaeva EN, Pletneva LK, Babenko VV, Boldyreva DI, Gorokhovatsky AY, Balakireva AV, Gao F, Choob VV, Encell LP, Wood KV, Yampolsky IV, Sarkisyan KS, Mishin AS. Nat Methods. 2024 Mar;21(3):406-410. doi: 10.1038/s41592-023-02152-y. Epub 2024 Jan 22. 10.1038/s41592-023-02152-y PubMed 38253843