pNK4169
(Plasmid #219744)

• Purpose: MoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 codon-optimised for expression in Pichia pastoris
• Depositing Lab: Alexander Mishin
• Publication: Shakhova et al Nat Methods. 2024 Mar;21(3):406-410. doi: 10.1038/s41592-023-02152-y. Epub 2024 Jan 22.

Backbone

• Vector backbone: Level 0-like
• Backbone size w/o insert (bp): 2247
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mutant of fungal hispidin-3-hydroxylase
• Alt name: nnH3H_v2
• Species: Neonothopanus nambi
• Insert Size (bp): 1266
• Mutation: D37E, V181I, S323M, M385K

Cloning Information

• Cloning method: Golden Gate
• 5′ sequencing primer: gagcgaggaagcggaagagcgccc
• 3′ sequencing primer: accattattatcatgacattaacc

Resource Information

• Supplemental Documents:
  • pNK4169.gb
• A portion of this plasmid was derived from a plasmid made by: Synthetic

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry