Skip to main content
Addgene

pD4sE_SC12
(Plasmid #219721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219721 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PalphaH
  • Backbone manufacturer
    modified from pHLSec
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DV4 sE SC12
  • Species
    Dengue virus
  • Insert Size (bp)
    1278
  • Mutation
    G106D, A259W, S262R, F279W, A280P, G29K, T33V, A25M
  • Tags / Fusion Proteins
    • human serum albumin (HSA) (N terminal on insert)
    • 8xHis (C terminal on insert)

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer GTGCTGTCTCATCATTTTGGCAAA
  • 3′ sequencing primer ACACCAGCCACCACCTTCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pD4sE_SC12 was a gift from Brian Kuhlman (Addgene plasmid # 219721 ; http://n2t.net/addgene:219721 ; RRID:Addgene_219721)
  • For your References section:

    A conserved set of mutations for stabilizing soluble envelope protein dimers from dengue and Zika viruses to advance the development of subunit vaccines. Phan TTN, Hvasta MG, Kudlacek ST, Thiono DJ, Tripathy A, Nicely NI, de Silva AM, Kuhlman B. J Biol Chem. 2022 Jul;298(7):102079. doi: 10.1016/j.jbc.2022.102079. Epub 2022 May 26. 10.1016/j.jbc.2022.102079 PubMed 35643320