pD3sE_SC12
(Plasmid #219720)

• Purpose: DV3 E dimer with fusion loop mutation and increased expression
• Depositing Lab: Brian Kuhlman
• Publication: Phan et al J Biol Chem. 2022 Jul;298(7):102079. doi: 10.1016/j.jbc.2022.102079. Epub 2022 May 26.

Backbone

• Vector backbone: PalphaH
• Backbone manufacturer: modified from pHLSec
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DV3 sE SC12
• Species: Dengue virus
• Insert Size (bp): 1272
• Mutation: G106D, A257W, T260R, F277W, A278P, G29K, T33V, A35M
• Tags / Fusion Proteins:
  • human serum albumin (HSA) (N terminal on insert)
  • 8xHis (C terminal on insert)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: GTGCTGTCTCATCATTTTGGCAAA
• 3′ sequencing primer: ACACCAGCCACCACCTTCT

Resource Information

• Supplemental Documents:
  • pD3sE_SC12.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry