Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pD2sE_SC10
(Plasmid #219716)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219716 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PalphaH
  • Backbone manufacturer
    modified from pHLSec
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DV2 sE SC10
  • Species
    Dengue virus
  • Insert Size (bp)
    1278
  • Mutation
    G106D, A259W, T262R, F279W, T280P
  • Tags / Fusion Proteins
    • human serum albumin (HSA) (N terminal on insert)
    • 8xHis (C terminal on insert)

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer GTGCTGTCTCATCATTTTGGCAAA
  • 3′ sequencing primer ACACCAGCCACCACCTTCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pD2sE_SC10 was a gift from Brian Kuhlman (Addgene plasmid # 219716 ; http://n2t.net/addgene:219716 ; RRID:Addgene_219716)
  • For your References section:

    Designed, highly expressing, thermostable dengue virus 2 envelope protein dimers elicit quaternary epitope antibodies. Kudlacek ST, Metz S, Thiono D, Payne AM, Phan TTN, Tian S, Forsberg LJ, Maguire J, Seim I, Zhang S, Tripathy A, Harrison J, Nicely NI, Soman S, McCracken MK, Gromowski GD, Jarman RG, Premkumar L, de Silva AM, Kuhlman B. Sci Adv. 2021 Oct 15;7(42):eabg4084. doi: 10.1126/sciadv.abg4084. Epub 2021 Oct 15. 10.1126/sciadv.abg4084 PubMed 34652943