pJP_Ctrl10
(Plasmid
#219672)
-
PurposeContains PT3lacO promoter (regulated by blue light and LacI) controlling the expression of mCherry. LacI is constitutively produced by pR promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219672 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJP_Ctrl05.2
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 6295
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namemCherry
- Promoter PT3lacO
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTGTTATCGCTACCCTGTC
- 3′ sequencing primer CAACGTTCAAATCCGCTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namelacI
- Promoter pR
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tcatggcaattctggaag
- 3′ sequencing primer GTCAGAAGTATTGGTAATCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.03.28.586779 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJP_Ctrl10 was a gift from Yolanda Schaerli (Addgene plasmid # 219672 ; http://n2t.net/addgene:219672 ; RRID:Addgene_219672) -
For your References section:
From resonance to chaos by modulating spatiotemporal patterns through a synthetic optogenetic oscillator. Park JH, Hollo G, Schaerli Y. Nat Commun. 2024 Aug 23;15(1):7284. doi: 10.1038/s41467-024-51626-w. 10.1038/s41467-024-51626-w PubMed 39179558