Skip to main content
Addgene

pCMV4 p65
(Plasmid #21966)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21966 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMV4
  • Backbone manufacturer
    Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989)
  • Backbone size w/o insert (bp) 4874
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NFkB p65 subunit
  • Alt name
    RelA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2500
  • Mutation
    This construct was the product of 3 subcloning procedures: 1. XbaI-EcoRI-p65-EcoRI-KpnI from pBluescript II SK +/- was digested with XbaI/KpnI, and subcloned to M13 mp19. 2. HindIII-XbaI-p65-HindIII-KpnI from the M13 mp19 construct was digested with HindIII, then subcloned into pCMV4. 3. The resulting pCMV4 p65 plasmid can be liberated using HindIII, with a size of ~2.5 kb. The large size (p65 is only 1.5kb) is due to the inclusion of multiple polylinkers from pBluescript and M13mp19 as well as non-coding regions of p65.
  • Entrez Gene
    RELA (a.k.a. AIF3BL3, CMCU, NFKB3, p65)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CMV forward: cgcaaatgggcggtaggcgtg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV4 p65 was a gift from Warner Greene (Addgene plasmid # 21966 ; http://n2t.net/addgene:21966 ; RRID:Addgene_21966)

  • For your References section:

    The 65-kDa subunit of human NF-kappa B functions as a potent transcriptional activator and a target for v-Rel-mediated repression. Ballard DW, Dixon EP, Peffer NJ, Bogerd H, Doerre S, Stein B, Greene WC. Proc Natl Acad Sci U S A. 1992 Mar 1. 89(5):1875-9. 10.1073/pnas.89.5.1875 PubMed 1542686
Related items:
Commonly requested with: