pAAV nEF 2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
(Plasmid
#219653)
-
PurposeGeneral mammalian expression of PACmn, a membrane targeted version of the photoactivatable adenylyl cyclase from Beggiatoa with lowered dark activity, with dark Venus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219653 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene / Agilent
- Backbone size w/o insert (bp) 4660
- Total vector size (bp) 6538
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
-
Alt namePACmn_dV
-
SpeciesH. sapiens (human), Synthetic; Aequoria victoria/Beggiatoa
-
Insert Size (bp)1878
- Promoter nEf Addgene # 149296
-
Tags
/ Fusion Proteins
- 2x Lyn11 (GCIKSKGKDS) (N terminal on insert)
- ER exit (FCYENE) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GAACTGCGTCCGCCGTCTAG
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInsert was assembled in the lab of Georg Nagel
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is identical to #165492 with promoter nEF taken from Addgene # 149296.
Please visit https://doi.org/10.1101/2024.02.16.580703 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV nEF 2xLyn-ERex-Venus(Y145W)-bPAC(F198Y) was a gift from Thomas Oertner (Addgene plasmid # 219653 ; http://n2t.net/addgene:219653 ; RRID:Addgene_219653)