pAAV nEF 2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
(Plasmid #219653)

• Purpose: General mammalian expression of PACmn, a membrane targeted version of the photoactivatable adenylyl cyclase from Beggiatoa with lowered dark activity, with dark Venus
• Depositing Lab: Thomas Oertner
• Publication: cAMP in synaptic plasticity (unpublished)

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene / Agilent
• Backbone size w/o insert (bp): 4660
• Total vector size (bp): 6538
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
• Alt name: PACmn_dV
• Species: H. sapiens (human), Synthetic; Aequoria victoria/Beggiatoa
• Insert Size (bp): 1878
• Promoter: nEf Addgene # 149296
• Tags / Fusion Proteins:
  • 2x Lyn11 (GCIKSKGKDS) (N terminal on insert)
  • ER exit (FCYENE) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GAACTGCGTCCGCCGTCTAG
• 3′ sequencing primer: GGCATTAAAGCAGCGTATCC

Resource Information

• Supplemental Documents:
  • pAAV nEF 2xLyn-ERex-Venus(Y145W)-bPAC(F198Y).gb
• A portion of this plasmid was derived from a plasmid made by: Insert was assembled in the lab of Georg Nagel

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is identical to #165492 with promoter nEF taken from Addgene # 149296.

Please visit https://doi.org/10.1101/2024.02.16.580703 for bioRxiv preprint.