Skip to main content
Addgene

LZRS-IresGFP
(Plasmid #21961)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21961 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LZRS-pBMN-Z-delta
  • Backbone size w/o insert (bp) 11476
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin ; puro selection for packaging cell only

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ires GFP
  • Alt name
    enhanced GFP
  • Insert Size (bp)
    1500
  • Mutation
    GACAGATGACTATGCAGAGAT

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LZRS-IresGFP was a gift from Lynda Chin (Addgene plasmid # 21961 ; http://n2t.net/addgene:21961 ; RRID:Addgene_21961)
  • For your References section:

    Comparative oncogenomics identifies NEDD9 as a melanoma metastasis gene. Kim M, Gans JD, Nogueira C, Wang A, Paik JH, Feng B, Brennan C, Hahn WC, Cordon-Cardo C, Wagner SN, Flotte TJ, Duncan LM, Granter SR, Chin L. Cell. 2006 Jun 30. 125(7):1269-81. 10.1016/j.cell.2006.06.008 PubMed 16814714