5` CC: Puro – loxP – GFP-C
(Plasmid
#219563)
-
Purpose5` circularization cassette.Used in combination with one of the 3' circularization cassettes to induce Cre-mediated circularizazion or inversion of a desired genomic region.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219563 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneEntry vector - pNC
- Total vector size (bp) 4234
-
Vector typeUnspecified
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehPGK-promoter_PuroR_2A_loxP_GFP-C
-
SpeciesSynthetic
-
Insert Size (bp)511
- Promoter hPGK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTGACCGAATCACCGACCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
5` CC: Puro – loxP – GFP-C was a gift from Andrea Ventura (Addgene plasmid # 219563 ; http://n2t.net/addgene:219563 ; RRID:Addgene_219563)