pLenti-Cre-MS2_UbC-GFP (Cre_GFP)
(Plasmid
#219536)
-
Purposea. Expresses Cre recombinase tagged with 21x repeats of MS2 binding sequence under EF1A promotor and b. GFP reporter under UbC promotor
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepRRLSIN.cPPT.PGK-GFP.WPRE
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsNEB Stable is preferred. Although stbl3 can be used. The plasmid is prone to recombination due to MS2 repeats.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCre recombinase
-
Alt nameCre
-
Insert Size (bp)1029
-
Entrez Genecre (a.k.a. P1_gp003)
Cloning Information for Gene/Insert 1
- Cloning method Other
- 5′ sequencing primer GGAGACTGAAGTTAGGCCAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGFP
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
1. A restriction-based cloning method is highly recommended for any changes/manipulation of this plasmid. Amplification of this plasmid OR restriction-free cloning enzymes may lead to undesired recombination.
2. The inserts "EF1A-Cre-MS2-RBGpA" and "UbC-GFP-pA" are placed in opposite orientations to ensure efficient lentivirus packaging. Further design consideration is based on https://www.intechopen.com/chapters/16787.
Please visit https://doi.org/10.1101/2024.11.06.622258 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-Cre-MS2_UbC-GFP (Cre_GFP) was a gift from Jeffrey Gerst (Addgene plasmid # 219536 ; http://n2t.net/addgene:219536 ; RRID:Addgene_219536) -
For your References section:
Complementation of a human disease phenotype in vitro by intercellular mRNA transfer. Haimovich G, Dasgupta S, Ravi AG, Gerst JE. bioRxiv 2024.11.06.622258 10.1101/2024.11.06.622258