pSCL758
(Plasmid
#219504)
-
PurposeExpress Eco3RT from a CAG promoter; also express an msr and HEK3, FANCF and EMX1 retron msd donor-gRNAs from a single H1 promoter, separated by tRNA-Cys-GCA sequences
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219504 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGGS
-
Backbone manufacturerBCCM
- Total vector size (bp) 4801
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemsr and HEK3, FANCF and EMX1 retron msd donor-gRNAs from a single H1 promoter, separated by tRNA-Cys-GCA sequences
-
SpeciesSynthetic
-
Insert Size (bp)117
- Promoter H1
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GAAATGTCTTTGGATTTGGGAATCTTATAAGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byUsed Addgene items #114454 (pZS157) and #41583 (pCAGGS-mCherry).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.07.17.549397v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCL758 was a gift from Seth Shipman (Addgene plasmid # 219504 ; http://n2t.net/addgene:219504 ; RRID:Addgene_219504) -
For your References section:
Simultaneous multi-site editing of individual genomes using retron arrays. Gonzalez-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. bioRxiv [Preprint]. 2023 Jul 17:2023.07.17.549397. doi: 10.1101/2023.07.17.549397. 10.1101/2023.07.17.549397 PubMed 37503029