pSCL390
(Plasmid #219500)

• Purpose: Integrating inducible cassette (Cas9-P2A-Csy4 and Eco1 RT) for yeast overexpression
• Depositing Lab: Seth Shipman
• Publication: Gonzalez-Delgado et al bioRxiv [Preprint]. 2023 Jul 17:2023.07.17.549397. doi: 10.1101/2023.07.17.549397.

Backbone

• Vector backbone: pZS157
• Backbone manufacturer: Addgene #114454
• Backbone size w/o insert (bp): 10663
• Total vector size (bp): 11323
• Vector type: Yeast Expression
• Selectable markers: HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Integrating inducible cassette: Cas9-P2A-Csy4 and Eco1 RT
• Species: Synthetic
• Insert Size (bp): 6476
• Promoter: GAL1-GAL10
• Tag / Fusion Protein:
  • SV40-NLS (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAATTAACCCTCACTAAAGG
• 3′ sequencing primer: TAATACGACTCACTATAGG

Resource Information

• Supplemental Documents:
  • pSCL390.gb
• A portion of this plasmid was derived from a plasmid made by: Used Addgene items #114454 (pZS157) and #41583 (pCAGGS-mCherry).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.07.17.549397v1 for bioRxiv preprint.