Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV4-BlaM-Vpr
(Plasmid #21950)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21950 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV4
  • Backbone manufacturer
    Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989)
  • Backbone size w/o insert (bp) 4874
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BlaM-Vpr
  • Species
    Fusion of BlaM and HIV-1 Vpr
  • Insert Size (bp)
    1100
  • Entrez Gene
    vpr (a.k.a. HIV1gp4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer CMV forward: cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer hGH-pA-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV4-BlaM-Vpr was a gift from Warner Greene (Addgene plasmid # 21950 ; http://n2t.net/addgene:21950 ; RRID:Addgene_21950)
  • For your References section:

    A sensitive and specific enzyme-based assay detecting HIV-1 virion fusion in primary T lymphocytes. Cavrois M, De Noronha C, Greene WC. Nat Biotechnol. 2002 Nov . 20(11):1151-4. 10.1038/nbt745 PubMed 12355096