pCIG2-IRES-Lamp1-mNeon Green
(Plasmid
#219441)
-
PurposeExpresses Lamp1 fused to mNeon Green
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219441 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCIG2
- Backbone size w/o insert (bp) 7450
- Total vector size (bp) 9379
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLAMP1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1932
-
GenBank IDNM_012857.1
-
Entrez GeneLamp1 (a.k.a. LGP120)
- Promoter CAG
-
Tag
/ Fusion Protein
- mNeonGreen (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gctcaagcttcgaattctgc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Jayne Aiken, as described in Aiken et al., Human Molecular Genetics (2019)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIG2-IRES-Lamp1-mNeon Green was a gift from Erika Holzbaur (Addgene plasmid # 219441 ; http://n2t.net/addgene:219441 ; RRID:Addgene_219441) -
For your References section:
A RAB7A phosphoswitch coordinates Rubicon Homology protein regulation of Parkin-dependent mitophagy. Tudorica DA, Basak B, Puerta Cordova AS, Khuu G, Rose K, Lazarou M, Holzbaur ELF, Hurley JH. J Cell Biol. 2024 Jul 1;223(7):e202309015. doi: 10.1083/jcb.202309015. Epub 2024 May 10. 10.1083/jcb.202309015 PubMed 38728007