Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAGT9054
(Plasmid #219430)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219430 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pICH47742
  • Backbone manufacturer
    Sylvestre Marillonnet
  • Backbone size w/o insert (bp) 4356
  • Total vector size (bp) 13721
  • Vector type
    Plant Expression, CRISPR ; MoClo compatible Level 1 module (position 2)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LB_2x35Ss-omega enhancer:PapE-4xLF2-NLS-SpCas9i-NLS:tOCS_RB (Position 2)
  • Alt name
    PapE-4LF2-Cas9
  • Species
    Synthetic; Cauliflower mosaic virus, Papiine 189 alpha Herpes Virus 2, Streptococcus pyogenes SF370, Agrobacterium tumefaciencs
  • Insert Size (bp)
    9707
  • Tag / Fusion Protein
    • PapE-4LF2 (N terminal on insert)

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer CTCTTTTCTCTTAGGTTTACCCGCC
  • 3′ sequencing primer TGTTGGCTGGCTGGTGGCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAGT9054 was a gift from Tom Schreiber (Addgene plasmid # 219430 ; http://n2t.net/addgene:219430 ; RRID:Addgene_219430)
  • For your References section:

    Efficient scar-free knock-ins of several kilobases in plants by engineered CRISPR/Cas endonucleases. Schreiber T, Prange A, Schafer P, Iwen T, Grutzner R, Marillonnet S, Lepage A, Javelle M, Paul W, Tissier A. Mol Plant. 2024 Mar 22:S1674-2052(24)00086-8. doi: 10.1016/j.molp.2024.03.013. 10.1016/j.molp.2024.03.013 PubMed 38520090