pNF02-mLemon
(Plasmid
#219399)
-
PurposeConstitutive expression of mLemonin E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 219399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepNF02
- Backbone size w/o insert (bp) 6548
- Total vector size (bp) 7265
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse 15µg/ml chloramphenicol
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemLemon
-
Alt namemLem
-
SpeciesA. victoria
-
Insert Size (bp)717
- Promoter proDp
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCACAACGGTTTCCCTCTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNF02-mLemon was a gift from Christian Lesterlin (Addgene plasmid # 219399 ; http://n2t.net/addgene:219399 ; RRID:Addgene_219399)