Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-Myc-CEBPA
(Plasmid #219393)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219393 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV-Myc
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CEBPA
  • Species
    H. sapiens (human)
  • Entrez Gene
    CEBPA (a.k.a. C/EBP-alpha, CEBP)
  • Tag / Fusion Protein
    • N terminal Myc tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AGGCCTGTACGGAAGTGTTACTT
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATCAATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-Myc-CEBPA was a gift from Yoichi Furukawa (Addgene plasmid # 219393 ; http://n2t.net/addgene:219393 ; RRID:Addgene_219393)
  • For your References section:

    Wnt/beta-catenin signaling regulates amino acid metabolism through the suppression of CEBPA and FOXA1 in liver cancer cells. Nakagawa S, Yamaguchi K, Takane K, Tabata S, Ikenoue T, Furukawa Y. Commun Biol. 2024 Apr 29;7(1):510. doi: 10.1038/s42003-024-06202-9. 10.1038/s42003-024-06202-9 PubMed 38684876