-
Purpose(Empty Backbone) 3rd generation lentiviral plasmid for inducible expression of shRNA; puromycin selection. See manual for detailed protocols. No further technical support is available from the depositing laboratory.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Cloning Grade DNA | 21915-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $105 |
Backbone
-
Vector backboneTet-pLKO-puro
- Backbone size (bp) 10633
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsrecommend rec-deficient E.coli (Stbl3, SURE) at 37C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Reference
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was called pLKO-Tet-On in the original publication. The name was changed to clarify that this plasmid does not contain and is not related to the trademarked Tet-On(R) system sold by Clontech. No other changes were made. Clontech does not support or recommend this product.
Please look at the manual associated with this plasmid for detailed protocols. Note that no additional technical support or troubleshooting is available from the laboratory that created this plasmid beyond the published manual.
For additional information please review the following reference -
Wee, S., Wiederschain, D., Maira, S.-M., Loo, A., Miller, C., deBeaumont, R., Stegmeier, F., Yao, Y.-M., and Lengauer, C. PTEN-deficient cancers depend on PIK3CB, Proc Natl Acad Sci U S A. 105: 13057-62, 2008.
Please cite the original publication when describing the use of this plasmid in a subsequent publication: Wiederschain et al., Cell Cycle. 2009 Feb 1. 8(3):498-504
Information for Cloning Grade DNA (Catalog # 21915-DNA.cg) ( Back to top)
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $105 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tet-pLKO-puro was a gift from Dmitri Wiederschain (Addgene plasmid # 21915 ; http://n2t.net/addgene:21915 ; RRID:Addgene_21915) -
For your References section:
Single-vector inducible lentiviral RNAi system for oncology target validation. Wiederschain D, Wee S, Chen L, Loo A, Yang G, Huang A, Chen Y, Caponigro G, Yao YM, Lengauer C, Sellers WR, Benson JD. Cell Cycle. 2009 Feb 1. 8(3):498-504. 10.4161/cc.8.3.7701 PubMed 19177017