Skip to main content
Addgene

Tet-pLKO-puro
(Plasmid #21915)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21915 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Cloning Grade DNA 21915-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $105

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone size (bp) 10633
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    recommend rec-deficient E.coli (Stbl3, SURE) at 37C
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was called pLKO-Tet-On in the original publication.  The name was changed to clarify that this plasmid does not contain and is not related to the trademarked Tet-On(R) system sold by Clontech.  No other changes were made.  Clontech does not support or recommend this product.  

Please look at the manual associated with this plasmid for detailed protocols. Note that no additional technical support or troubleshooting is available from the laboratory that created this plasmid beyond the published manual.

For additional information please review the following reference -
Wee, S., Wiederschain, D., Maira, S.-M., Loo, A., Miller, C., deBeaumont, R., Stegmeier, F., Yao, Y.-M., and Lengauer, C. (2008). PTEN-deficient cancers depend on PIK3CB. Proc Natl Acad Sci U S A. 105: 13057-62. https://doi.org/10.1073/pnas.0802655105

Please cite the original publication when describing the use of this plasmid in a subsequent publication: Wiederschain et al., Cell Cycle. 2009 Feb 1. 8(3):498-504

Information for Cloning Grade DNA (Catalog # 21915-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $105 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tet-pLKO-puro was a gift from Dmitri Wiederschain (Addgene plasmid # 21915 ; http://n2t.net/addgene:21915 ; RRID:Addgene_21915)
  • For your References section:

    Single-vector inducible lentiviral RNAi system for oncology target validation. Wiederschain D, Wee S, Chen L, Loo A, Yang G, Huang A, Chen Y, Caponigro G, Yao YM, Lengauer C, Sellers WR, Benson JD. Cell Cycle. 2009 Feb 1. 8(3):498-504. 10.4161/cc.8.3.7701 PubMed 19177017