LvPolyUb
(Plasmid
#218982)
-
PurposeL.variegatus polyubiquitin-C promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218982 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTwist Bioscience High Copy Amp
-
Backbone manufacturerTwist Bioscience
- Backbone size w/o insert (bp) 2233
- Total vector size (bp) 5672
-
Vector typesea urchin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL.variegatus polyubiquitinC promoter
-
SpeciesSynthetic; Lytechinus variegatus
-
Insert Size (bp)3439
- Promoter L.variegatus polyubiquitinC promoter
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer AGCGGATAACAATTTCACACAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LvPolyUb was a gift from Amro Hamdoun (Addgene plasmid # 218982 ; http://n2t.net/addgene:218982 ; RRID:Addgene_218982)