proinsulin-msGFP2 (C48S C70S)
(Plasmid
#218956)
-
PurposeExpresses proinsulin fused to msGFP2 (C48S C70S) in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepQ60NA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameproinsulin-msGFP2 C48S C70S
- Promoter T5
-
Tag
/ Fusion Protein
- proinsulin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer AATAGATTCAATTGTGAGCGGATAACAATTTCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
proinsulin-msGFP2 (C48S C70S) was a gift from Benjamin Glick (Addgene plasmid # 218956 ; http://n2t.net/addgene:218956 ; RRID:Addgene_218956)