H2B-Electra2
(Plasmid
#218929)
-
PurposeElectra2 fused to human H2B protein for nuclear localization
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCS2+8
- Backbone size w/o insert (bp) 4137
- Total vector size (bp) 5243
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-Electra2
-
Alt nameH2B-BFP
-
SpeciesH. sapiens (human), Synthetic; Entacmaea quadricolor
-
Insert Size (bp)1110
-
Entrez GeneH2B
-
Tags
/ Fusion Proteins
- Electra2 (C terminal on backbone)
- H2B (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TGACGTAAATGGGCGGTAGG
- 3′ sequencing primer CTCGCTCACTGACTCGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byTwist Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H2B-Electra2 was a gift from Amro Hamdoun (Addgene plasmid # 218929 ; http://n2t.net/addgene:218929 ; RRID:Addgene_218929)