Skip to main content
Addgene

pLCHKOv3-mClover-intergenic_3-As
(Plasmid #218815)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218815 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLCHKOv3-Clover3 (Plasmid #209034)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin ; mClover3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    intergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
  • gRNA/shRNA sequence
    TACTGACTGAAGATGGAGGCGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTAATTTCTACTCTTGTAGATACAAGTATGTTATCCTGTTGTGT
  • Species
    Synthetic
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLCHKOv3-mClover-intergenic_3-As was a gift from Thomas Gonatopoulos-Pournatzis (Addgene plasmid # 218815 ; http://n2t.net/addgene:218815 ; RRID:Addgene_218815)

  • For your References section:

    Genome-scale exon perturbation screens uncover exons critical for cell fitness. Xiao M-S, Damodaran AP, Kumari B, Dickson E, Xing K, On TA, Parab N, King HE, Perez AR, Guiblet WM, Duncan G, Che A, Chari R, Andresson T, Vidigal JA, Weatheritt RJ, Aregger M, Gonatopoulos-Pournatzis T. Mol Cell. 2024 June 24. doi: 10.1016/j.molcel.2024.05.024. 10.1016/j.molcel.2024.05.024
Related items: