pEGFP-C1-IFT43
(Plasmid
#218735)
-
PurposeExpresses N-terminally EGFP-tagged IFT43 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT43
-
SpeciesH. sapiens (human)
-
Insert Size (bp)642
-
Entrez GeneIFT43 (a.k.a. C14orf179, CED3, RP81, SRTD18)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-IFT43 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218735 ; http://n2t.net/addgene:218735 ; RRID:Addgene_218735) -
For your References section:
Molecular basis of ciliary defects caused by compound heterozygous IFT144/WDR19 mutations found in cranioectodermal dysplasia. Ishida Y, Kobayashi T, Chiba S, Katoh Y, Nakayama K. Hum Mol Genet. 2021 Apr 26;30(3-4):213-225. doi: 10.1093/hmg/ddab034. 10.1093/hmg/ddab034 PubMed 33517396